1QWB | pdb_00001qwb

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12


SOLUTION NMR
NMR Experiment
ExperimentTypeSample ContentsSolventIonic StrengthpHPressureTemperature (K)Spectrometer
12D NOESY1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O95% H2O/5% D2O100mM KCl7ambient278
22D NOESY1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN399.999% D2O100mM KCl7ambient298
32D TOCSY1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN399.999% D2O100mM KCl7ambient298
4DQF-COSY1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN399.999% D2O100mM KCl7ambient298
51H-13C HSQC or HMQC1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN399.999% D2O100mM KCl7ambient298
61H-15N HMQC1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O95% H2O/5% D2O100mM KCl7ambient278
NMR Spectrometer Information
SpectrometerManufacturerModelField Strength
1BrukerDMX500
2BrukerDMX600
NMR Refinement
MethodDetailsSoftware
simulated annealingXwinNMR
NMR Ensemble Information
Conformer Selection Criteriaall calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy
Conformers Calculated Total Number17
Conformers Submitted Total Number17
Representative Model1 (lowest energy)
Additional NMR Experimental Information
DetailsAssignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998).
Computation: NMR Software
#ClassificationVersionSoftware NameAuthor
1collectionXwinNMR2.6Bruker
2data analysisAURELIA3.108Bruker
3structure solutionX-PLORNIHBrunger
4refinementX-PLORNIHBrunger