NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
SOLUTION NMR
NMR Experiment | ||||||||
---|---|---|---|---|---|---|---|---|
Experiment | Type | Sample Contents | Solvent | Ionic Strength | pH | Pressure | Temperature (K) | Spectrometer |
1 | 2D NOESY | 1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O | 95% H2O/5% D2O | 100mM KCl | 7 | ambient | 278 | |
2 | 2D NOESY | 1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3 | 99.999% D2O | 100mM KCl | 7 | ambient | 298 | |
3 | 2D TOCSY | 1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3 | 99.999% D2O | 100mM KCl | 7 | ambient | 298 | |
4 | DQF-COSY | 1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3 | 99.999% D2O | 100mM KCl | 7 | ambient | 298 | |
5 | 1H-13C HSQC or HMQC | 1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3 | 99.999% D2O | 100mM KCl | 7 | ambient | 298 | |
6 | 1H-15N HMQC | 1mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O | 95% H2O/5% D2O | 100mM KCl | 7 | ambient | 278 |
NMR Spectrometer Information | |||
---|---|---|---|
Spectrometer | Manufacturer | Model | Field Strength |
1 | Bruker | DMX | 500 |
2 | Bruker | DMX | 600 |
NMR Refinement | ||
---|---|---|
Method | Details | Software |
simulated annealing | XwinNMR |
NMR Ensemble Information | |
---|---|
Conformer Selection Criteria | all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy |
Conformers Calculated Total Number | 17 |
Conformers Submitted Total Number | 17 |
Representative Model | 1 (lowest energy) |
Additional NMR Experimental Information | |
---|---|
Details | Assignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998). |
Computation: NMR Software | ||||
---|---|---|---|---|
# | Classification | Version | Software Name | Author |
1 | collection | XwinNMR | 2.6 | Bruker |
2 | data analysis | AURELIA | 3.108 | Bruker |
3 | structure solution | X-PLOR | NIH | Brunger |
4 | refinement | X-PLOR | NIH | Brunger |